Review




Structured Review

Benchling Inc crispr sgrna design tool of benchling
( A ) A pie chart describing the different <t>sgRNA</t> sub-libraries. For each sub-library, the number of targeted genes and sgRNAs is specified (the number of genes is listed in brackets, and the number of sgRNAs is indicated within the pie chart). As non-targeting sgRNAs do not correspond to existing genes, the number of genes for this sub-library is not mentioned. ( B ) A volcano plot showing targeted gene hits from <t>tRNA-CRISPR</t> screen of HFF cell growth. The x-axis shows the Z-score of log2 fold change (FC) between competing cells (3 days of competition) and ancestor samples (median of log2 FC for all high-ranked sgRNAs per gene). The y-axis shows the –log10 FDR as calculated using the MAGeCK tool. The genes are marked according to the sub-libraries. Significance is determined by FDR < 0.05 and marked with dashed gray lines. All values are calculated for three biological repeats. ( C ) A heat map showing the (−log10) p -value of the hypergeometric test, which tests the enrichment of each sub-library in one of the following groups: significantly depleted in competing cells (log2FC < 0, FDR < 0.05) or significantly enriched in competing cells (log2FC > 0, FDR < 0.05). ( D ) Differences in the essentiality of tRNA isodecoders that are the sole targets of their corresponding sgRNA. tRNA essentiality is determined by the median log2 FC of its corresponding sgRNA between competing and ancestor cells. The arrow points towards higher tRNA essentiality. tRNA isoaceptors are denoted on the x-axis. Each dot corresponds to a different isodecoder type within the isoaceptor family. The number of isodecoders per tRNA family is mentioned in parentheses. ( E ) Comparison between the (log2) expression of the tRNA isodecoder in HFF (x-axis) and their essentiality, as shown in Fig. 5D (y-axis). The arrow points towards higher tRNA essentiality. Pearson correlation r = −0.41, p -value = 0.04.
Crispr Sgrna Design Tool Of Benchling, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+sgrna+design+tools/pmc13046961-39-0-5?v=Benchling+Inc
Average 86 stars, based on 1 article reviews
crispr sgrna design tool of benchling - by Bioz Stars, 2026-06
86/100 stars

Images

1) Product Images from "Essentiality and dynamic expression of the human tRNA pool during viral infection"

Article Title: Essentiality and dynamic expression of the human tRNA pool during viral infection

Journal: Molecular Systems Biology

doi: 10.1038/s44320-025-00181-7

( A ) A pie chart describing the different sgRNA sub-libraries. For each sub-library, the number of targeted genes and sgRNAs is specified (the number of genes is listed in brackets, and the number of sgRNAs is indicated within the pie chart). As non-targeting sgRNAs do not correspond to existing genes, the number of genes for this sub-library is not mentioned. ( B ) A volcano plot showing targeted gene hits from tRNA-CRISPR screen of HFF cell growth. The x-axis shows the Z-score of log2 fold change (FC) between competing cells (3 days of competition) and ancestor samples (median of log2 FC for all high-ranked sgRNAs per gene). The y-axis shows the –log10 FDR as calculated using the MAGeCK tool. The genes are marked according to the sub-libraries. Significance is determined by FDR < 0.05 and marked with dashed gray lines. All values are calculated for three biological repeats. ( C ) A heat map showing the (−log10) p -value of the hypergeometric test, which tests the enrichment of each sub-library in one of the following groups: significantly depleted in competing cells (log2FC < 0, FDR < 0.05) or significantly enriched in competing cells (log2FC > 0, FDR < 0.05). ( D ) Differences in the essentiality of tRNA isodecoders that are the sole targets of their corresponding sgRNA. tRNA essentiality is determined by the median log2 FC of its corresponding sgRNA between competing and ancestor cells. The arrow points towards higher tRNA essentiality. tRNA isoaceptors are denoted on the x-axis. Each dot corresponds to a different isodecoder type within the isoaceptor family. The number of isodecoders per tRNA family is mentioned in parentheses. ( E ) Comparison between the (log2) expression of the tRNA isodecoder in HFF (x-axis) and their essentiality, as shown in Fig. 5D (y-axis). The arrow points towards higher tRNA essentiality. Pearson correlation r = −0.41, p -value = 0.04.
Figure Legend Snippet: ( A ) A pie chart describing the different sgRNA sub-libraries. For each sub-library, the number of targeted genes and sgRNAs is specified (the number of genes is listed in brackets, and the number of sgRNAs is indicated within the pie chart). As non-targeting sgRNAs do not correspond to existing genes, the number of genes for this sub-library is not mentioned. ( B ) A volcano plot showing targeted gene hits from tRNA-CRISPR screen of HFF cell growth. The x-axis shows the Z-score of log2 fold change (FC) between competing cells (3 days of competition) and ancestor samples (median of log2 FC for all high-ranked sgRNAs per gene). The y-axis shows the –log10 FDR as calculated using the MAGeCK tool. The genes are marked according to the sub-libraries. Significance is determined by FDR < 0.05 and marked with dashed gray lines. All values are calculated for three biological repeats. ( C ) A heat map showing the (−log10) p -value of the hypergeometric test, which tests the enrichment of each sub-library in one of the following groups: significantly depleted in competing cells (log2FC < 0, FDR < 0.05) or significantly enriched in competing cells (log2FC > 0, FDR < 0.05). ( D ) Differences in the essentiality of tRNA isodecoders that are the sole targets of their corresponding sgRNA. tRNA essentiality is determined by the median log2 FC of its corresponding sgRNA between competing and ancestor cells. The arrow points towards higher tRNA essentiality. tRNA isoaceptors are denoted on the x-axis. Each dot corresponds to a different isodecoder type within the isoaceptor family. The number of isodecoders per tRNA family is mentioned in parentheses. ( E ) Comparison between the (log2) expression of the tRNA isodecoder in HFF (x-axis) and their essentiality, as shown in Fig. 5D (y-axis). The arrow points towards higher tRNA essentiality. Pearson correlation r = −0.41, p -value = 0.04.

Techniques Used: CRISPR, Comparison, Expressing

( A ) A schematic representation of the experimental setup and distributions of the measured GFP levels of uninfected HFF cells (upper panel), HCMV-infected HFF cells with non-targeting sgRNA (middle panel), and CRISPR-targeted and HCMV-infected HFF cells (lower panel). The percentage of cells in each of the GFP levels, GFP1-4, is marked in the middle and lower panels. ( B ) A volcano plot for targeted gene hits from tRNA-CRISPR screen in HCMV infection. The x-axis shows the Z-score of log2 FC between lowly infected cells (GFP2) and highly infected cells (GFP4). The y-axis shows the –log10 FDR as calculated from MAGeCK. The genes are marked according to the sub-libraries. Significance is determined by FDR < 0.05. All values are calculated for three biological repeats. ( C ) A heat map showing the (−log10) p -value of the hypergeometric test, which tests the enrichment of each sub-library in one of the following groups: significantly enriched in GFP2 cells (log2FC > 0, FDR < 0.05) or significantly depleted in GFP2 cells (log2FC < 0, FDR < 0.05). ( D ) The number of viral genomes estimated by the relative number of UL44 normalized to the B2M human gene, calculated by qPCR, in each individual CRISPR knockout. The dots in each bar depict three or four biological repeats. P -values represent statistical significance of differences between each group and the non-targeting control, as evaluated using Welch’s t-test with Holm correction for multiple comparisons. ( E , F ) Expression level (RPM) determined from tRNA-sequencing of ( E ) iMet-CAT-1-1 gene and ( F ) His-GTG-1-1 gene in cells targeted by non-targeting sgRNA (NT) or by sgRNAs corresponding to the tested tRNA. The dots in each bar depict three biological repeats. ( G ) A heat map describes the z-score log2FC between the different lowly infected cell populations (GFP1, GFP2, GFP3) and the highly infected cells (GFP4) for the significant gene hits. Genes found as significant hits in at least one of the comparisons are presented here. Non-significant hits are marked in gray squares. The genes are colored and marked according to their sub-library, corresponding to the colors and marker shapes described in the legend of Fig. 6B. The dendrogram depicts the similarity between the comparisons based on the enrichment gene hits pattern.
Figure Legend Snippet: ( A ) A schematic representation of the experimental setup and distributions of the measured GFP levels of uninfected HFF cells (upper panel), HCMV-infected HFF cells with non-targeting sgRNA (middle panel), and CRISPR-targeted and HCMV-infected HFF cells (lower panel). The percentage of cells in each of the GFP levels, GFP1-4, is marked in the middle and lower panels. ( B ) A volcano plot for targeted gene hits from tRNA-CRISPR screen in HCMV infection. The x-axis shows the Z-score of log2 FC between lowly infected cells (GFP2) and highly infected cells (GFP4). The y-axis shows the –log10 FDR as calculated from MAGeCK. The genes are marked according to the sub-libraries. Significance is determined by FDR < 0.05. All values are calculated for three biological repeats. ( C ) A heat map showing the (−log10) p -value of the hypergeometric test, which tests the enrichment of each sub-library in one of the following groups: significantly enriched in GFP2 cells (log2FC > 0, FDR < 0.05) or significantly depleted in GFP2 cells (log2FC < 0, FDR < 0.05). ( D ) The number of viral genomes estimated by the relative number of UL44 normalized to the B2M human gene, calculated by qPCR, in each individual CRISPR knockout. The dots in each bar depict three or four biological repeats. P -values represent statistical significance of differences between each group and the non-targeting control, as evaluated using Welch’s t-test with Holm correction for multiple comparisons. ( E , F ) Expression level (RPM) determined from tRNA-sequencing of ( E ) iMet-CAT-1-1 gene and ( F ) His-GTG-1-1 gene in cells targeted by non-targeting sgRNA (NT) or by sgRNAs corresponding to the tested tRNA. The dots in each bar depict three biological repeats. ( G ) A heat map describes the z-score log2FC between the different lowly infected cell populations (GFP1, GFP2, GFP3) and the highly infected cells (GFP4) for the significant gene hits. Genes found as significant hits in at least one of the comparisons are presented here. Non-significant hits are marked in gray squares. The genes are colored and marked according to their sub-library, corresponding to the colors and marker shapes described in the legend of Fig. 6B. The dendrogram depicts the similarity between the comparisons based on the enrichment gene hits pattern.

Techniques Used: Infection, CRISPR, Knock-Out, Control, Expressing, Sequencing, Marker



Similar Products

86
Benchling Inc crispr sgrna design tool of benchling
( A ) A pie chart describing the different <t>sgRNA</t> sub-libraries. For each sub-library, the number of targeted genes and sgRNAs is specified (the number of genes is listed in brackets, and the number of sgRNAs is indicated within the pie chart). As non-targeting sgRNAs do not correspond to existing genes, the number of genes for this sub-library is not mentioned. ( B ) A volcano plot showing targeted gene hits from <t>tRNA-CRISPR</t> screen of HFF cell growth. The x-axis shows the Z-score of log2 fold change (FC) between competing cells (3 days of competition) and ancestor samples (median of log2 FC for all high-ranked sgRNAs per gene). The y-axis shows the –log10 FDR as calculated using the MAGeCK tool. The genes are marked according to the sub-libraries. Significance is determined by FDR < 0.05 and marked with dashed gray lines. All values are calculated for three biological repeats. ( C ) A heat map showing the (−log10) p -value of the hypergeometric test, which tests the enrichment of each sub-library in one of the following groups: significantly depleted in competing cells (log2FC < 0, FDR < 0.05) or significantly enriched in competing cells (log2FC > 0, FDR < 0.05). ( D ) Differences in the essentiality of tRNA isodecoders that are the sole targets of their corresponding sgRNA. tRNA essentiality is determined by the median log2 FC of its corresponding sgRNA between competing and ancestor cells. The arrow points towards higher tRNA essentiality. tRNA isoaceptors are denoted on the x-axis. Each dot corresponds to a different isodecoder type within the isoaceptor family. The number of isodecoders per tRNA family is mentioned in parentheses. ( E ) Comparison between the (log2) expression of the tRNA isodecoder in HFF (x-axis) and their essentiality, as shown in Fig. 5D (y-axis). The arrow points towards higher tRNA essentiality. Pearson correlation r = −0.41, p -value = 0.04.
Crispr Sgrna Design Tool Of Benchling, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+sgrna+design+tools/pmc13046961-39-0-5?v=Benchling+Inc
Average 86 stars, based on 1 article reviews
crispr sgrna design tool of benchling - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Benchling Inc crispr sgrna design tool in benchling
( A ) A pie chart describing the different <t>sgRNA</t> sub-libraries. For each sub-library, the number of targeted genes and sgRNAs is specified (the number of genes is listed in brackets, and the number of sgRNAs is indicated within the pie chart). As non-targeting sgRNAs do not correspond to existing genes, the number of genes for this sub-library is not mentioned. ( B ) A volcano plot showing targeted gene hits from <t>tRNA-CRISPR</t> screen of HFF cell growth. The x-axis shows the Z-score of log2 fold change (FC) between competing cells (3 days of competition) and ancestor samples (median of log2 FC for all high-ranked sgRNAs per gene). The y-axis shows the –log10 FDR as calculated using the MAGeCK tool. The genes are marked according to the sub-libraries. Significance is determined by FDR < 0.05 and marked with dashed gray lines. All values are calculated for three biological repeats. ( C ) A heat map showing the (−log10) p -value of the hypergeometric test, which tests the enrichment of each sub-library in one of the following groups: significantly depleted in competing cells (log2FC < 0, FDR < 0.05) or significantly enriched in competing cells (log2FC > 0, FDR < 0.05). ( D ) Differences in the essentiality of tRNA isodecoders that are the sole targets of their corresponding sgRNA. tRNA essentiality is determined by the median log2 FC of its corresponding sgRNA between competing and ancestor cells. The arrow points towards higher tRNA essentiality. tRNA isoaceptors are denoted on the x-axis. Each dot corresponds to a different isodecoder type within the isoaceptor family. The number of isodecoders per tRNA family is mentioned in parentheses. ( E ) Comparison between the (log2) expression of the tRNA isodecoder in HFF (x-axis) and their essentiality, as shown in Fig. 5D (y-axis). The arrow points towards higher tRNA essentiality. Pearson correlation r = −0.41, p -value = 0.04.
Crispr Sgrna Design Tool In Benchling, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+sgrna+design+tools/pm41559190-275-1-6?v=Benchling+Inc
Average 86 stars, based on 1 article reviews
crispr sgrna design tool in benchling - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Benchling Inc crispr sgrna design tool
( A ) A pie chart describing the different <t>sgRNA</t> sub-libraries. For each sub-library, the number of targeted genes and sgRNAs is specified (the number of genes is listed in brackets, and the number of sgRNAs is indicated within the pie chart). As non-targeting sgRNAs do not correspond to existing genes, the number of genes for this sub-library is not mentioned. ( B ) A volcano plot showing targeted gene hits from <t>tRNA-CRISPR</t> screen of HFF cell growth. The x-axis shows the Z-score of log2 fold change (FC) between competing cells (3 days of competition) and ancestor samples (median of log2 FC for all high-ranked sgRNAs per gene). The y-axis shows the –log10 FDR as calculated using the MAGeCK tool. The genes are marked according to the sub-libraries. Significance is determined by FDR < 0.05 and marked with dashed gray lines. All values are calculated for three biological repeats. ( C ) A heat map showing the (−log10) p -value of the hypergeometric test, which tests the enrichment of each sub-library in one of the following groups: significantly depleted in competing cells (log2FC < 0, FDR < 0.05) or significantly enriched in competing cells (log2FC > 0, FDR < 0.05). ( D ) Differences in the essentiality of tRNA isodecoders that are the sole targets of their corresponding sgRNA. tRNA essentiality is determined by the median log2 FC of its corresponding sgRNA between competing and ancestor cells. The arrow points towards higher tRNA essentiality. tRNA isoaceptors are denoted on the x-axis. Each dot corresponds to a different isodecoder type within the isoaceptor family. The number of isodecoders per tRNA family is mentioned in parentheses. ( E ) Comparison between the (log2) expression of the tRNA isodecoder in HFF (x-axis) and their essentiality, as shown in Fig. 5D (y-axis). The arrow points towards higher tRNA essentiality. Pearson correlation r = −0.41, p -value = 0.04.
Crispr Sgrna Design Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+sgrna+design+tools/bio_rxiv__2025__10__15__682590-75-17-22?v=Benchling+Inc
Average 86 stars, based on 1 article reviews
crispr sgrna design tool - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

90
Benchling Inc sgrnas design tool for crispr
( A ) Schematic of the dCas9-TET1 IL1RN promoter epigenome editing. The four <t>sgRNAs</t> targeting the IL1RN TSS are shown. #1 to #4 indicate the CpGs analyzed in (C). ( B ) ChIP-qPCR showing dCas9-TET1 enrichment at the IL1RN promoter. A 5-kb downstream region from the TSS is shown as a negative control region. Unpaired two-tailed Student’s t test, n = 3, mean SEM, (**** P < 0.0001). ( C ) DNAm levels (pyrosequencing) at four CpGs upstream of IL1RN TSS [as in (A)] in CTRL and edited B cells. One-way analysis of variance (ANOVA) with Dunnett’s post hoc correction, n = 3, means ± SEM, (* P < 0.05; ** P < 0.01, *** P <<0.001,**** P < 0.0001). ( D ) Top, IL1RN expression (RT-qPCR) in CTRL and edited B cells. Unpaired two-tailed Student’s t test, n = 3, means ± SEM, (*** P < 0.001). Bottom, IL1RN protein levels in CTRL and edited B cells. Fold change normalized to β-actin (CTRL versus sgIL1RN). ( E ) Schematic of the dCas9-DNMT3A IL1RN promoter epigenome editing experiment as in (A), showing two Infinium MethylationEPIC v2.0 probes. ( F ) Genome browser snapshot showing dCas9-DNMT3A binding at the IL1RN promoter. The location of the four sgRNAs targeting the IL1RN promoter and the two array probes is depicted. ( G ) Scatter plot showing differential dCas9-DNMT3A enrichment in sgIL1RN B cells. Large dots indicate top-bound promoters. ( H ) Scatter plot showing differentially hypermethylated CpGs in sgIL1RN day-3 cells. Blue dots indicate significantly hypermethylated CpGs (Δβ ≥ 0.3, FDR < 0.05, n = 13). Yellow dots highlight IL1RN probes shown in (E). ( I ) MA plot showing DEGs in sgIL1RN day-3 cells. ( J ) Upset plot depicting overlap of the dCas9-DNMT3A–binding sites, hypermethylated CpGs, and DEGs. ( K ) DNAm dynamics (array data) of two significantly hypermethylated IL1RN promoter CpGs. Unpaired two-tailed Student’s t test, n = 4, means ± SEM, (**** P < 0.0001). ( L ) IL1RN dynamics (RNA-seq) in CTRL and edited cells. Unpaired two-tailed Student’s t test, n = 2, means ± SEM, (*** P < 0.001).
Sgrnas Design Tool For Crispr, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+sgrna+design+tools/pmc12266127-268-17-23?v=Benchling+Inc
Average 90 stars, based on 1 article reviews
sgrnas design tool for crispr - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation crispr sgrna design tool
( A ) Schematic of the dCas9-TET1 IL1RN promoter epigenome editing. The four <t>sgRNAs</t> targeting the IL1RN TSS are shown. #1 to #4 indicate the CpGs analyzed in (C). ( B ) ChIP-qPCR showing dCas9-TET1 enrichment at the IL1RN promoter. A 5-kb downstream region from the TSS is shown as a negative control region. Unpaired two-tailed Student’s t test, n = 3, mean SEM, (**** P < 0.0001). ( C ) DNAm levels (pyrosequencing) at four CpGs upstream of IL1RN TSS [as in (A)] in CTRL and edited B cells. One-way analysis of variance (ANOVA) with Dunnett’s post hoc correction, n = 3, means ± SEM, (* P < 0.05; ** P < 0.01, *** P <<0.001,**** P < 0.0001). ( D ) Top, IL1RN expression (RT-qPCR) in CTRL and edited B cells. Unpaired two-tailed Student’s t test, n = 3, means ± SEM, (*** P < 0.001). Bottom, IL1RN protein levels in CTRL and edited B cells. Fold change normalized to β-actin (CTRL versus sgIL1RN). ( E ) Schematic of the dCas9-DNMT3A IL1RN promoter epigenome editing experiment as in (A), showing two Infinium MethylationEPIC v2.0 probes. ( F ) Genome browser snapshot showing dCas9-DNMT3A binding at the IL1RN promoter. The location of the four sgRNAs targeting the IL1RN promoter and the two array probes is depicted. ( G ) Scatter plot showing differential dCas9-DNMT3A enrichment in sgIL1RN B cells. Large dots indicate top-bound promoters. ( H ) Scatter plot showing differentially hypermethylated CpGs in sgIL1RN day-3 cells. Blue dots indicate significantly hypermethylated CpGs (Δβ ≥ 0.3, FDR < 0.05, n = 13). Yellow dots highlight IL1RN probes shown in (E). ( I ) MA plot showing DEGs in sgIL1RN day-3 cells. ( J ) Upset plot depicting overlap of the dCas9-DNMT3A–binding sites, hypermethylated CpGs, and DEGs. ( K ) DNAm dynamics (array data) of two significantly hypermethylated IL1RN promoter CpGs. Unpaired two-tailed Student’s t test, n = 4, means ± SEM, (**** P < 0.0001). ( L ) IL1RN dynamics (RNA-seq) in CTRL and edited cells. Unpaired two-tailed Student’s t test, n = 2, means ± SEM, (*** P < 0.001).
Crispr Sgrna Design Tool, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+sgrna+design+tools/pmc12167463-26-5-10?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
crispr sgrna design tool - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Benchling Inc crispr sgrna design tools
B7-H3 deficiency in tumor cells augmented the CD8 + T cells anti-tumor immunity. A-B The B7-H3 knockout B16 cell line was constructed based on <t>CRISPR/Cas9.</t> Validation of the effective knockout of B7-H3 within B16 cells was accomplished through sequencing (A) and flow cytometry (B). C CCK-8 was employed to ascertain the effect of B7-H3 knockout on the proliferation of B16 cells. D The effect of B7-H3 knockout on the apoptosis of B16 cells was detected utilizing flow cytometry (n = 6). E Schematic diagram illustrating the inoculation of C57BL/6 mice with either WT or B7-H3 KO B16 cells. F - H B16 tumor volume (F), tumor growth curve(G) and tumor weight (H) of B7H3 KO and B16 WT groups were assessed. Tumor volumes were determined through the application of the formula: 0.5 × (small diameter) 2 × (large diameter) (n = 6). I Schematic diagram illustrating the inoculation of C57BL/6 mice with either WT or B7-H3 KO Hepa1-6 cells. J - L Hepa1-6 tumor volume (J), tumor growth curve(K) and tumor weight (L) of B7H3 KO and Hepa1-6 WT groups were assessed. Tumor volumes were determined through the application of the formula: 0.5 × (small diameter) 2 × (large diameter) (n = 5). M The percentage of CD4 + and CD8 + T cells within the population of CD45 + cells on the day14 following B16 tumor inoculation was achieved through flow cytometry analysis (n = 6). N The Co-expression of PD-1 and TIM-3 in tumor-infiltrating CD8 + T cells was quantified in the murine tumor-bearing model among B16 KO group and B16 WT group. O Co-expression of IFN-γ and TNF-α in the proportion of tumor-infiltrating CD8 + T cells in the B7-H3 KO group and B16 WT groups (n = 6). P The percentage of granzyme B + (GZMB) perforin + among tumor-infiltrating CD8 + T cells between B7-H3 KO group and B16 WT groups (n = 6). Q Schematic diagram illustrating the inoculation of C57BL/6 mice with either WT or B7-H3 KO B16 cells treated with/without αCD8. R - T B16 tumor volume (R), tumor growth curve (S) and tumor weight (T) of WT + IgG, WT + αCD8, B7H3 KO + IgG and B7H3 KO + αCD8 groups were assessed. Tumor volumes were determined through the application of the formula: 0.5 × (small diameter) 2 × (large diameter) (n = 5). U-V The quantification of CD8 + T cells within the population of CD45 + cells on the day10 following B16 tumor and spleen inoculation was achieved through flow cytometry analysis. Data represent mean ± SD. Statistical significance was performed through the utilization of an unpaired t-test (D, H, L, M-P), two-way ANOVA (C, G, K, S) and one-way ANOVA comparisons test (T) with the corresponding results expressed as follows: ns, non-significant, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Crispr Sgrna Design Tools, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+sgrna+design+tools/pmc11840737-106-2-7?v=Benchling+Inc
Average 90 stars, based on 1 article reviews
crispr sgrna design tools - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


( A ) A pie chart describing the different sgRNA sub-libraries. For each sub-library, the number of targeted genes and sgRNAs is specified (the number of genes is listed in brackets, and the number of sgRNAs is indicated within the pie chart). As non-targeting sgRNAs do not correspond to existing genes, the number of genes for this sub-library is not mentioned. ( B ) A volcano plot showing targeted gene hits from tRNA-CRISPR screen of HFF cell growth. The x-axis shows the Z-score of log2 fold change (FC) between competing cells (3 days of competition) and ancestor samples (median of log2 FC for all high-ranked sgRNAs per gene). The y-axis shows the –log10 FDR as calculated using the MAGeCK tool. The genes are marked according to the sub-libraries. Significance is determined by FDR < 0.05 and marked with dashed gray lines. All values are calculated for three biological repeats. ( C ) A heat map showing the (−log10) p -value of the hypergeometric test, which tests the enrichment of each sub-library in one of the following groups: significantly depleted in competing cells (log2FC < 0, FDR < 0.05) or significantly enriched in competing cells (log2FC > 0, FDR < 0.05). ( D ) Differences in the essentiality of tRNA isodecoders that are the sole targets of their corresponding sgRNA. tRNA essentiality is determined by the median log2 FC of its corresponding sgRNA between competing and ancestor cells. The arrow points towards higher tRNA essentiality. tRNA isoaceptors are denoted on the x-axis. Each dot corresponds to a different isodecoder type within the isoaceptor family. The number of isodecoders per tRNA family is mentioned in parentheses. ( E ) Comparison between the (log2) expression of the tRNA isodecoder in HFF (x-axis) and their essentiality, as shown in Fig. 5D (y-axis). The arrow points towards higher tRNA essentiality. Pearson correlation r = −0.41, p -value = 0.04.

Journal: Molecular Systems Biology

Article Title: Essentiality and dynamic expression of the human tRNA pool during viral infection

doi: 10.1038/s44320-025-00181-7

Figure Lengend Snippet: ( A ) A pie chart describing the different sgRNA sub-libraries. For each sub-library, the number of targeted genes and sgRNAs is specified (the number of genes is listed in brackets, and the number of sgRNAs is indicated within the pie chart). As non-targeting sgRNAs do not correspond to existing genes, the number of genes for this sub-library is not mentioned. ( B ) A volcano plot showing targeted gene hits from tRNA-CRISPR screen of HFF cell growth. The x-axis shows the Z-score of log2 fold change (FC) between competing cells (3 days of competition) and ancestor samples (median of log2 FC for all high-ranked sgRNAs per gene). The y-axis shows the –log10 FDR as calculated using the MAGeCK tool. The genes are marked according to the sub-libraries. Significance is determined by FDR < 0.05 and marked with dashed gray lines. All values are calculated for three biological repeats. ( C ) A heat map showing the (−log10) p -value of the hypergeometric test, which tests the enrichment of each sub-library in one of the following groups: significantly depleted in competing cells (log2FC < 0, FDR < 0.05) or significantly enriched in competing cells (log2FC > 0, FDR < 0.05). ( D ) Differences in the essentiality of tRNA isodecoders that are the sole targets of their corresponding sgRNA. tRNA essentiality is determined by the median log2 FC of its corresponding sgRNA between competing and ancestor cells. The arrow points towards higher tRNA essentiality. tRNA isoaceptors are denoted on the x-axis. Each dot corresponds to a different isodecoder type within the isoaceptor family. The number of isodecoders per tRNA family is mentioned in parentheses. ( E ) Comparison between the (log2) expression of the tRNA isodecoder in HFF (x-axis) and their essentiality, as shown in Fig. 5D (y-axis). The arrow points towards higher tRNA essentiality. Pearson correlation r = −0.41, p -value = 0.04.

Article Snippet: CRISPR sgRNA design tool of Benchling , https://benchling.com , .

Techniques: CRISPR, Comparison, Expressing

( A ) A schematic representation of the experimental setup and distributions of the measured GFP levels of uninfected HFF cells (upper panel), HCMV-infected HFF cells with non-targeting sgRNA (middle panel), and CRISPR-targeted and HCMV-infected HFF cells (lower panel). The percentage of cells in each of the GFP levels, GFP1-4, is marked in the middle and lower panels. ( B ) A volcano plot for targeted gene hits from tRNA-CRISPR screen in HCMV infection. The x-axis shows the Z-score of log2 FC between lowly infected cells (GFP2) and highly infected cells (GFP4). The y-axis shows the –log10 FDR as calculated from MAGeCK. The genes are marked according to the sub-libraries. Significance is determined by FDR < 0.05. All values are calculated for three biological repeats. ( C ) A heat map showing the (−log10) p -value of the hypergeometric test, which tests the enrichment of each sub-library in one of the following groups: significantly enriched in GFP2 cells (log2FC > 0, FDR < 0.05) or significantly depleted in GFP2 cells (log2FC < 0, FDR < 0.05). ( D ) The number of viral genomes estimated by the relative number of UL44 normalized to the B2M human gene, calculated by qPCR, in each individual CRISPR knockout. The dots in each bar depict three or four biological repeats. P -values represent statistical significance of differences between each group and the non-targeting control, as evaluated using Welch’s t-test with Holm correction for multiple comparisons. ( E , F ) Expression level (RPM) determined from tRNA-sequencing of ( E ) iMet-CAT-1-1 gene and ( F ) His-GTG-1-1 gene in cells targeted by non-targeting sgRNA (NT) or by sgRNAs corresponding to the tested tRNA. The dots in each bar depict three biological repeats. ( G ) A heat map describes the z-score log2FC between the different lowly infected cell populations (GFP1, GFP2, GFP3) and the highly infected cells (GFP4) for the significant gene hits. Genes found as significant hits in at least one of the comparisons are presented here. Non-significant hits are marked in gray squares. The genes are colored and marked according to their sub-library, corresponding to the colors and marker shapes described in the legend of Fig. 6B. The dendrogram depicts the similarity between the comparisons based on the enrichment gene hits pattern.

Journal: Molecular Systems Biology

Article Title: Essentiality and dynamic expression of the human tRNA pool during viral infection

doi: 10.1038/s44320-025-00181-7

Figure Lengend Snippet: ( A ) A schematic representation of the experimental setup and distributions of the measured GFP levels of uninfected HFF cells (upper panel), HCMV-infected HFF cells with non-targeting sgRNA (middle panel), and CRISPR-targeted and HCMV-infected HFF cells (lower panel). The percentage of cells in each of the GFP levels, GFP1-4, is marked in the middle and lower panels. ( B ) A volcano plot for targeted gene hits from tRNA-CRISPR screen in HCMV infection. The x-axis shows the Z-score of log2 FC between lowly infected cells (GFP2) and highly infected cells (GFP4). The y-axis shows the –log10 FDR as calculated from MAGeCK. The genes are marked according to the sub-libraries. Significance is determined by FDR < 0.05. All values are calculated for three biological repeats. ( C ) A heat map showing the (−log10) p -value of the hypergeometric test, which tests the enrichment of each sub-library in one of the following groups: significantly enriched in GFP2 cells (log2FC > 0, FDR < 0.05) or significantly depleted in GFP2 cells (log2FC < 0, FDR < 0.05). ( D ) The number of viral genomes estimated by the relative number of UL44 normalized to the B2M human gene, calculated by qPCR, in each individual CRISPR knockout. The dots in each bar depict three or four biological repeats. P -values represent statistical significance of differences between each group and the non-targeting control, as evaluated using Welch’s t-test with Holm correction for multiple comparisons. ( E , F ) Expression level (RPM) determined from tRNA-sequencing of ( E ) iMet-CAT-1-1 gene and ( F ) His-GTG-1-1 gene in cells targeted by non-targeting sgRNA (NT) or by sgRNAs corresponding to the tested tRNA. The dots in each bar depict three biological repeats. ( G ) A heat map describes the z-score log2FC between the different lowly infected cell populations (GFP1, GFP2, GFP3) and the highly infected cells (GFP4) for the significant gene hits. Genes found as significant hits in at least one of the comparisons are presented here. Non-significant hits are marked in gray squares. The genes are colored and marked according to their sub-library, corresponding to the colors and marker shapes described in the legend of Fig. 6B. The dendrogram depicts the similarity between the comparisons based on the enrichment gene hits pattern.

Article Snippet: CRISPR sgRNA design tool of Benchling , https://benchling.com , .

Techniques: Infection, CRISPR, Knock-Out, Control, Expressing, Sequencing, Marker

( A ) Schematic of the dCas9-TET1 IL1RN promoter epigenome editing. The four sgRNAs targeting the IL1RN TSS are shown. #1 to #4 indicate the CpGs analyzed in (C). ( B ) ChIP-qPCR showing dCas9-TET1 enrichment at the IL1RN promoter. A 5-kb downstream region from the TSS is shown as a negative control region. Unpaired two-tailed Student’s t test, n = 3, mean SEM, (**** P < 0.0001). ( C ) DNAm levels (pyrosequencing) at four CpGs upstream of IL1RN TSS [as in (A)] in CTRL and edited B cells. One-way analysis of variance (ANOVA) with Dunnett’s post hoc correction, n = 3, means ± SEM, (* P < 0.05; ** P < 0.01, *** P <<0.001,**** P < 0.0001). ( D ) Top, IL1RN expression (RT-qPCR) in CTRL and edited B cells. Unpaired two-tailed Student’s t test, n = 3, means ± SEM, (*** P < 0.001). Bottom, IL1RN protein levels in CTRL and edited B cells. Fold change normalized to β-actin (CTRL versus sgIL1RN). ( E ) Schematic of the dCas9-DNMT3A IL1RN promoter epigenome editing experiment as in (A), showing two Infinium MethylationEPIC v2.0 probes. ( F ) Genome browser snapshot showing dCas9-DNMT3A binding at the IL1RN promoter. The location of the four sgRNAs targeting the IL1RN promoter and the two array probes is depicted. ( G ) Scatter plot showing differential dCas9-DNMT3A enrichment in sgIL1RN B cells. Large dots indicate top-bound promoters. ( H ) Scatter plot showing differentially hypermethylated CpGs in sgIL1RN day-3 cells. Blue dots indicate significantly hypermethylated CpGs (Δβ ≥ 0.3, FDR < 0.05, n = 13). Yellow dots highlight IL1RN probes shown in (E). ( I ) MA plot showing DEGs in sgIL1RN day-3 cells. ( J ) Upset plot depicting overlap of the dCas9-DNMT3A–binding sites, hypermethylated CpGs, and DEGs. ( K ) DNAm dynamics (array data) of two significantly hypermethylated IL1RN promoter CpGs. Unpaired two-tailed Student’s t test, n = 4, means ± SEM, (**** P < 0.0001). ( L ) IL1RN dynamics (RNA-seq) in CTRL and edited cells. Unpaired two-tailed Student’s t test, n = 2, means ± SEM, (*** P < 0.001).

Journal: Science Advances

Article Title: Modulating immune cell fate and inflammation through CRISPR-mediated DNA methylation editing

doi: 10.1126/sciadv.adt1644

Figure Lengend Snippet: ( A ) Schematic of the dCas9-TET1 IL1RN promoter epigenome editing. The four sgRNAs targeting the IL1RN TSS are shown. #1 to #4 indicate the CpGs analyzed in (C). ( B ) ChIP-qPCR showing dCas9-TET1 enrichment at the IL1RN promoter. A 5-kb downstream region from the TSS is shown as a negative control region. Unpaired two-tailed Student’s t test, n = 3, mean SEM, (**** P < 0.0001). ( C ) DNAm levels (pyrosequencing) at four CpGs upstream of IL1RN TSS [as in (A)] in CTRL and edited B cells. One-way analysis of variance (ANOVA) with Dunnett’s post hoc correction, n = 3, means ± SEM, (* P < 0.05; ** P < 0.01, *** P <<0.001,**** P < 0.0001). ( D ) Top, IL1RN expression (RT-qPCR) in CTRL and edited B cells. Unpaired two-tailed Student’s t test, n = 3, means ± SEM, (*** P < 0.001). Bottom, IL1RN protein levels in CTRL and edited B cells. Fold change normalized to β-actin (CTRL versus sgIL1RN). ( E ) Schematic of the dCas9-DNMT3A IL1RN promoter epigenome editing experiment as in (A), showing two Infinium MethylationEPIC v2.0 probes. ( F ) Genome browser snapshot showing dCas9-DNMT3A binding at the IL1RN promoter. The location of the four sgRNAs targeting the IL1RN promoter and the two array probes is depicted. ( G ) Scatter plot showing differential dCas9-DNMT3A enrichment in sgIL1RN B cells. Large dots indicate top-bound promoters. ( H ) Scatter plot showing differentially hypermethylated CpGs in sgIL1RN day-3 cells. Blue dots indicate significantly hypermethylated CpGs (Δβ ≥ 0.3, FDR < 0.05, n = 13). Yellow dots highlight IL1RN probes shown in (E). ( I ) MA plot showing DEGs in sgIL1RN day-3 cells. ( J ) Upset plot depicting overlap of the dCas9-DNMT3A–binding sites, hypermethylated CpGs, and DEGs. ( K ) DNAm dynamics (array data) of two significantly hypermethylated IL1RN promoter CpGs. Unpaired two-tailed Student’s t test, n = 4, means ± SEM, (**** P < 0.0001). ( L ) IL1RN dynamics (RNA-seq) in CTRL and edited cells. Unpaired two-tailed Student’s t test, n = 2, means ± SEM, (*** P < 0.001).

Article Snippet: The design of the sgRNAs targeting the IL1RN promoter (chr2:113,127,440-113,127,701) and CTRL regions was performed using Benchling sgRNAs design tool for CRISPR ( https://benchling.com/crispr ). sgRNAs close to a protospacer adjacent motif with 5′-NGG-3′ were selected with the best on-target and off-target scores.

Techniques: ChIP-qPCR, Negative Control, Two Tailed Test, Expressing, Quantitative RT-PCR, Binding Assay, RNA Sequencing

B7-H3 deficiency in tumor cells augmented the CD8 + T cells anti-tumor immunity. A-B The B7-H3 knockout B16 cell line was constructed based on CRISPR/Cas9. Validation of the effective knockout of B7-H3 within B16 cells was accomplished through sequencing (A) and flow cytometry (B). C CCK-8 was employed to ascertain the effect of B7-H3 knockout on the proliferation of B16 cells. D The effect of B7-H3 knockout on the apoptosis of B16 cells was detected utilizing flow cytometry (n = 6). E Schematic diagram illustrating the inoculation of C57BL/6 mice with either WT or B7-H3 KO B16 cells. F - H B16 tumor volume (F), tumor growth curve(G) and tumor weight (H) of B7H3 KO and B16 WT groups were assessed. Tumor volumes were determined through the application of the formula: 0.5 × (small diameter) 2 × (large diameter) (n = 6). I Schematic diagram illustrating the inoculation of C57BL/6 mice with either WT or B7-H3 KO Hepa1-6 cells. J - L Hepa1-6 tumor volume (J), tumor growth curve(K) and tumor weight (L) of B7H3 KO and Hepa1-6 WT groups were assessed. Tumor volumes were determined through the application of the formula: 0.5 × (small diameter) 2 × (large diameter) (n = 5). M The percentage of CD4 + and CD8 + T cells within the population of CD45 + cells on the day14 following B16 tumor inoculation was achieved through flow cytometry analysis (n = 6). N The Co-expression of PD-1 and TIM-3 in tumor-infiltrating CD8 + T cells was quantified in the murine tumor-bearing model among B16 KO group and B16 WT group. O Co-expression of IFN-γ and TNF-α in the proportion of tumor-infiltrating CD8 + T cells in the B7-H3 KO group and B16 WT groups (n = 6). P The percentage of granzyme B + (GZMB) perforin + among tumor-infiltrating CD8 + T cells between B7-H3 KO group and B16 WT groups (n = 6). Q Schematic diagram illustrating the inoculation of C57BL/6 mice with either WT or B7-H3 KO B16 cells treated with/without αCD8. R - T B16 tumor volume (R), tumor growth curve (S) and tumor weight (T) of WT + IgG, WT + αCD8, B7H3 KO + IgG and B7H3 KO + αCD8 groups were assessed. Tumor volumes were determined through the application of the formula: 0.5 × (small diameter) 2 × (large diameter) (n = 5). U-V The quantification of CD8 + T cells within the population of CD45 + cells on the day10 following B16 tumor and spleen inoculation was achieved through flow cytometry analysis. Data represent mean ± SD. Statistical significance was performed through the utilization of an unpaired t-test (D, H, L, M-P), two-way ANOVA (C, G, K, S) and one-way ANOVA comparisons test (T) with the corresponding results expressed as follows: ns, non-significant, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

Journal: Theranostics

Article Title: Histone lactylation-driven B7-H3 expression promotes tumor immune evasion

doi: 10.7150/thno.105947

Figure Lengend Snippet: B7-H3 deficiency in tumor cells augmented the CD8 + T cells anti-tumor immunity. A-B The B7-H3 knockout B16 cell line was constructed based on CRISPR/Cas9. Validation of the effective knockout of B7-H3 within B16 cells was accomplished through sequencing (A) and flow cytometry (B). C CCK-8 was employed to ascertain the effect of B7-H3 knockout on the proliferation of B16 cells. D The effect of B7-H3 knockout on the apoptosis of B16 cells was detected utilizing flow cytometry (n = 6). E Schematic diagram illustrating the inoculation of C57BL/6 mice with either WT or B7-H3 KO B16 cells. F - H B16 tumor volume (F), tumor growth curve(G) and tumor weight (H) of B7H3 KO and B16 WT groups were assessed. Tumor volumes were determined through the application of the formula: 0.5 × (small diameter) 2 × (large diameter) (n = 6). I Schematic diagram illustrating the inoculation of C57BL/6 mice with either WT or B7-H3 KO Hepa1-6 cells. J - L Hepa1-6 tumor volume (J), tumor growth curve(K) and tumor weight (L) of B7H3 KO and Hepa1-6 WT groups were assessed. Tumor volumes were determined through the application of the formula: 0.5 × (small diameter) 2 × (large diameter) (n = 5). M The percentage of CD4 + and CD8 + T cells within the population of CD45 + cells on the day14 following B16 tumor inoculation was achieved through flow cytometry analysis (n = 6). N The Co-expression of PD-1 and TIM-3 in tumor-infiltrating CD8 + T cells was quantified in the murine tumor-bearing model among B16 KO group and B16 WT group. O Co-expression of IFN-γ and TNF-α in the proportion of tumor-infiltrating CD8 + T cells in the B7-H3 KO group and B16 WT groups (n = 6). P The percentage of granzyme B + (GZMB) perforin + among tumor-infiltrating CD8 + T cells between B7-H3 KO group and B16 WT groups (n = 6). Q Schematic diagram illustrating the inoculation of C57BL/6 mice with either WT or B7-H3 KO B16 cells treated with/without αCD8. R - T B16 tumor volume (R), tumor growth curve (S) and tumor weight (T) of WT + IgG, WT + αCD8, B7H3 KO + IgG and B7H3 KO + αCD8 groups were assessed. Tumor volumes were determined through the application of the formula: 0.5 × (small diameter) 2 × (large diameter) (n = 5). U-V The quantification of CD8 + T cells within the population of CD45 + cells on the day10 following B16 tumor and spleen inoculation was achieved through flow cytometry analysis. Data represent mean ± SD. Statistical significance was performed through the utilization of an unpaired t-test (D, H, L, M-P), two-way ANOVA (C, G, K, S) and one-way ANOVA comparisons test (T) with the corresponding results expressed as follows: ns, non-significant, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

Article Snippet: Using Benchling CRISPR sgRNA design tools ( https://benchling.com/crispr ) to design B7-H3 sgRNA sequence of gene targeting (B7-H3 KO-sgRNA: GCGCGTCCGAGTAACCGACG).

Techniques: Knock-Out, Construct, CRISPR, Biomarker Discovery, Sequencing, Flow Cytometry, CCK-8 Assay, Expressing